Abstract
Graphical abstract
Abstract
Renin–angiotensin system plays a critical role in blood pressure control, and the abnormal activation of the AT1 receptor contributes to the development of renovascular hypertension. This study aimed to evaluate the underlying cellular signaling for AT1 receptor activation by Ang II and to compare this mechanism between aortas from 2K-1C and 2K rats. Effects of antagonists and inhibitors were investigated on Ang II-induced contractions in denuded or intact-endothelium aortas. The AT1 receptor antagonist abolished Ang II-induced contraction in 2K-1C and 2K rat aortas, while AT2 and Mas receptors antagonists had no effect. Endothelial nitric oxide synthase inhibition increased the maximal effect (Emax) of Ang II in 2K, which was not changed in 2K-1C aortas. It was associated with lower eNOS mRNA levels in 2K-1C. Endothelium removal increased the Emax of Ang II in 2K-1C and mainly in 2K rat aortas. Nox and COX inhibition did not alter Ang II-induced contraction in 2K and 2K-1C rat aortas. However, AT1 expression was higher in 2K-1C compared to 2K rat aortic rings, whereas expression of phosphorylated (active) IP3 receptors was lower in 2K-1C than in 2K rats. These results demonstrate that endothelium removal impairs Ang II-stimulated contraction in the aorta of 2K-1C rats, which is associated with the reduction of IP3 receptor phosphorylation and activation. In addition, eNOS plays a critical role in Ang II-induced contraction in 2K rat aortas. It is possible that the high Ang II plasma levels could desensitize AT1 receptor in 2K-1C rats, leading to impaired IP3 receptors activation.
Introduction
Hypertension induces changes in the cardiovascular system, particularly in blood vessels, causing endothelial dysfunction (1). Consequently, a hypercontractile profile arises in vascular smooth muscle cells (VSMC) of renal hypertensive rats (2K-1C, two-kidney, one-clip model) (2).
Angiotensin II (Ang II) is a systemic peptide hormone produced by the renin–angiotensin–aldosterone system (RAAS), which participates in long-term blood pressure regulation (3). The effectiveness of RAAS blockers in reducing blood pressure demonstrates the close relationship between Ang II and hypertension (4).
Ang II produces its effects on blood vessels by binding to type 1 (AT1) (5) and type 2 (AT2) receptors (6). AT1 receptors are essentially expressed in VSMC and mediate the physiological vasoconstrictor effects of Ang II (7). Meanwhile, AT2 receptors are detected in vasculature, and their vasodilator effects involve different pathways (8). Under the action of angiotensin-converting enzyme 2 (ACE2), Ang II is converted to Ang-(1–7) (9), which interacts with Mas receptors and promotes vasodilation. Moreover, Ang-(1–7) can bind to AT1 receptors, thus inhibiting the actions of Ang II (10).
The aforementioned receptors are linked to heterotrimeric G-proteins coupled receptors (GPCRs) like Gq/11, Gi, G12, and G13. AT1 receptor activation elicits VSMC contraction by activation of phospholipase C beta (PLC-β) and formation of the second messenger inositol-1,4,5-trisphosphate (IP3) and diacylglycerol, which is followed by calcium release from the sarcoplasmic reticulum by IP3 receptors (11). Likewise, activated AT1 receptors are linked to reactive oxygen species (ROS) production by NADPH oxidase (Nox) (12). In addition, the RAAS can be activated by reduced renal blood flow, which increases renin release and generates Ang II (13). Therefore, the renovascular hypertension model (14) is suitable for mimicking continuous physiological RAAS activation upon increments in Ang II levels.
Our lab and other research groups have shown worsened endothelial function (15, 16, 17), increased ROS production (18, 19), and cardiac and VSMC hypertrophy (20, 21) in the renovascular hypertension model. Moreover, Ang II stimulation can desensitize AT1 receptors in cell culture within a short time (22), which is a typical phenomenon of GPCRs (23).
Because the RAAS is extensively activated in 2K-1C rats, we wondered whether the mechanisms of Ang II-induced contraction could be altered in blood vessels. We hypothesized that the Ang II-induced contractile response would be lower in 2K-1C rats due to constant AT1 receptor activation by Ang II. Therefore, in this study, we aimed to evaluate the direct vasocontractile property of Ang II in 2K-1C rat aorta and the underlying cellular mechanisms involved in the possible alterations.
Methods
Animals
Experiments were performed on adult male Wistar and Wistar-Hannover rats (180–200 g) obtained from the Animal Facility on the Campus of the University of São Paulo in Ribeirão Preto. The rats were housed at controlled temperature (23.0 ± 2ºC), exposed to a daily 12 h light:12 h darkness cycle, and provided with food and water ad libitum. All experimental protocols complied with the guidelines of the Ethics Committee on Animal Experimentation of the Faculty of Pharmaceutical Sciences of Ribeirão Preto, University of São Paulo (License CEUA 17.1.617.60.0).
Induction of 2K-1C renovascular hypertension
The rats were anesthetized with tribromoethanol (2.5 mg kg−1, i.p.). After midline laparotomy, a silver clip with an internal diameter of 0.20 mm was placed around the left renal artery of some rats; this group was named as 2K-1C hypertensive rats. Normotensive two-kidney (2K, Sham) rats were submitted to laparotomy only. Before and after surgery (laparotomy or clip implantation), all the rats had their blood pressure measured using the indirect tail-cuff method. For this study, 2K rats were included with systolic blood pressure ≤120 mm Hg and 2K-1C rats with systolic blood pressure ≥ 160 mm Hg. Some rats had their blood pressure measured weekly in order to demonstrate the development of renovascular hypertension, as shown in Fig. 1A.
Systolic blood pressure (SBP, mm Hg) measurements in normotensive (2K) and hypertensive (2K-1C) rats, and ACh-induced relaxation. (A) Each point represents the mean ± s.e.m.of measurements carried out for 6 weeks after induction of renovascular hypertension (2K-1C) or Sham surgery (2K) (n = 4–6). *Difference in relation to 2K (P < 0.05). Student's t-test. (B) Concentration–effect curves were constructed in isolated aorta of 2K (n = 4) and 2K-1C (n = 5) rats pre-contracted with phenylephrine. *Difference in the maximum effect with P < 0.05. Student's t-test. In addition, the results of SBP and concentration–effect responses are expressed as area under the curve (AUC, in arbitrary units).
Citation: Vascular Biology 6, 1; 10.1530/VB-23-0021
Preparation of aortas and vascular reactivity experiments
Male Wistar and Wistar-Hannover rats were killed by decapitation under isoflurane anesthesia 6 weeks after surgery. The thoracic aorta was dissected of connective tissue, cut into 4-mm long rings, which were placed between two stainless-steel stirrups to measure tension in an isometric force transducer in presence of Krebs solution (pH 7.4, 37ºC, 95% O2 and 5% CO2). The aortic rings were submitted to a basal tension of 1.5 g during 60 min for stabilization. Endothelial integrity was assessed by relaxation elicited by acetylcholine (ACh, 1 µmol/L) in the presence of contractile tone induced by phenylephrine (0.1 µmol/L). The endothelium was considered functional when relaxation was greater than 80% in 2K aortic rings and greater than 60% in 2K-1C aortic rings, thus being named as aortic rings with intact endothelium (E+). To investigate the role that Ang II plays in the smooth muscle layer, some aortic rings had their endothelium mechanically removed by rubbing the lumen to provide endothelium-free or denuded (E−) aortic rings with no degree of relaxation to ACh.
Next, concentration–effect curves to Ang II (0.1 nmol/L–0.1 μmol/L) were constructed for E+ and E− aortic rings. Some E+ aortic rings were incubated for 30 min in the absence (control) or in the presence of AT1 receptor antagonist (losartan, 1 μmol/L), AT2 receptor antagonist (PD123319, 1 μmol/L), Mas receptor antagonist (A779, 10 μmol/L), non-selective NOS inhibitor (L-NAME, 100 μmol/L), non-selective COX inhibitor (indomethacin, 10 μmol/L), or Nox inhibitor (apocynin, 100 μmol/L).
Real-time polymerase chain reaction
Total RNA was extracted from the E+ aortic ring samples using the SV total RNA isolation system (Promega Corporation, Madison, WI, USA); the manufacturer’s instructions were followed. cDNA was synthesized from 10 µg of total RNA using the high capacity cDNA reverse transcription and stored at −20ºC until use. Gene expression analysis of eNOS was performed by qRT-PCR, using Real-Time PCR instrument and kit (Taqman, Applied Biosystems, Waltham, MA, USA). All the primers showed efficiency higher than 90%. The results were analyzed as 2−(ΔΔCt) method. Specific sequences of the eNOS (forward: AGCATGAGGCCTTGGTATTG; reverse: CCCGACATTTCCATCAGC; Rn02132634_s1) and GAPDH (forward: TGACTCTACCCACGGCAAGTT; reverse TGATGGGTTTCCCGTTGATGA; Rn01775763_g1) primers.
Western blot
To determine the expression of AT1 and AT2 receptors, E+ aortas cleaned of blood and fat tissue, were used. To determine phosphorylated IP3 (phospho-IP3) receptors, total IP3 receptors, and myosin light chain (MLC), E-aortic rings were employed. Each sample was homogenized in protein ice-cold lysis buffer RIPA in the presence of protease and phosphatase inhibitors. Protein concentrations in the samples were determined using the Bradford technique. The proteins were separated from the tissue (30 µg) on 8–12% SDS-PAGE and transferred to a nitrocellulose membrane. The membranes were blocked with 5% bovine serum albumin (BSA) at room temperature for 60 min. Then, the membranes were incubated with a primary antibody against AT1 receptor (sc-1173 – Santa Cruz Biotechnology, 1:500), AT2 receptor (sc-9040 – Santa Cruz Biotechnology, 1:500), IP3 receptor (8568S – Cell Signaling Technology, 1:1000), phospho-IP3 receptor (3760S – Cell Signaling Technology, 1:1000), or MLC (8505S – Cell Signaling Technology, 1:1000) overnight. On the next day, the membranes were incubated with an HRP-conjugated secondary anti-rabbit (NA9340V – Abcam, 1:5000) body at room temperature for 60 min. Bands were detected by using autoradiography or a camera system that produces images of chemiluminescent components (Image Quant LAS 4000); α-tubulin or β-actin was used to normalize the results. The bands were quantified with the ImageJ Software (NIH Image).
Colorimetric Griess reaction
After decapitation, blood from both rat groups (2K and 2K-1C) was collected in a tube with heparin and submitted to centrifugation to separate the plasma. Then, 50 μL of plasma from groups 2K-1C and 2K rats were collected and added to 50 μL of Griess reagent (a 1:1 dilution of 1% N-(1-naphthyl)ethylenediamine dihydrochloride in distilled water and sulfanilamide 1% in 5% phosphoric acid) in a 96-well plate. The standard curve of sodium nitrite ranged from 3 μmol/L to 200 μmol/L for nitrite. Absorbance was read at 540 nm. Results were normalized to total protein concentration.
Angiotensin II levels
Plasma samples were used to evaluate circulating Ang II levels by ELISA; the angiotensin II kit (Sigma-Aldrich, RAB0010) was employed. The assay was performed according to the manufacturer’s instructions, and the detection limits were 0.1–1000 pg/mL.
Statistical analysis
The pharmacological parameters efficacy (maximum effect, Emax) and potency (pD2) obtained from the concentration–effect curves to Ang II were used to express the data. Emax was considered as the maximal amplitude response reached in the concentration–effect curves to the contractile agent. The concentration of the agent that produced half-amplitude of the maximum concentration was determined after logarithmic transformation of the normalized concentration–effect curves and it is reported as negative logarithm (pD2) of the mean of individual values. In addition, the data were expressed as area under curve (AUC) in arbitrary units, which was calculated from the concentration–effect curves. As for n, it refers to the number of rats. The data are expressed as the mean ± standard error of the mean (s.e.m.). Statistical analyses were performed by using the software Prism 5.0 (GraphPad). Student’s t-test or two-way ANOVA followed by Tukey post hoc test was applied when necessary to compare the results. Differences were considered statistically significant when P < 0.05.
Results
Blood pressure increases and endothelial function is impaired in 2K-1C rats
As depicted in Fig. 1A, blood pressure increased in 2K-1C rats 2 weeks after induction of hypertension and remained high until the last measurement. The values of the AUC, that in this case represents the magnitude of hypertension, was higher in 2K-1C. After 6 weeks, we tested the endothelial function by ACh-induced relaxation in some aortas from 2K and 2K-1C rats. Figure 1B shows that the Emax to ACh as well as AUC were decreased in 2K-1C, but the pD2 values were similar to 2K rat aortas, which demonstrate impaired endothelial function in 2K-1C rat aortas. These results demonstrated that the surgery induced hypertension and impaired the vascular function.
Ang II-induced contraction depends on AT1 receptors in endothelium-intact aortic rings
Based on Fig. 2A, the concentration–response curve induced by Ang II produced a low contraction in aortic rings with endothelium (E+) of 2K-1C and 2R rats. Although the profile of the concentration–effect curves shifted slightly to the right, Emax and pD2 of 2K-1C (Emax: 0.23 ± 0.08 g; pD2: 8.37 ± 0.14; n = 7) and 2K (Emax: 0.35 ± 0.10 g; pD2: 8.52 ± 0.09; n = 12) rat aortas did not differ, as well as AUC values (2K: 0.54 ± 0.14; 2K-1C: 0.25 ± 0.05; arbitrary units). Next, we used selective antagonists to evaluate the role of AT1, AT2, and Mas receptor activation by Ang II. Figure 2B and C shows that losartan abolished the Ang II-induced contractile response in 2K (Emax from 0.30 ± 0.12 g to −0.002 ± 0.004 g) and in 2K-1C (Emax from 0.15 ± 0.03 g to −0.01 ± 0.01 g) rat aortas. In addition, losartan decreased the AUC values in 2K (0.01 ± 0.002, arbitrary units) and 2K-1C (0.02 ± 0.005, arbitrary units). On the other hand, the AT2 receptor antagonist PD123319 did not change the Ang II-induced contractile response in 2K (Fig. 2D) or 2K-1C (Fig. 2E) rat aortas, neither changed the AUC values in both groups. The Mas receptor antagonist A779 did not change the Ang II-induced contractile response or AUC in 2K (Fig. 2F) or 2K-1C (Fig. 2G) rat aortas, either.
Ang II-induced contraction in endothelium-intact rat aortas. Concentration–effect curves to Ang II were constructed for endothelium-intact (E+) aortas in the (A) absence (control), (B, C) in the presence of AT1 receptor antagonist (losartan, 10 µmol/L), (D, E) AT2 receptor antagonist (PD123319, 1 µmol/L), or (F, G) Mas receptor antagonist (A779, 10 µmol/L) in normotensive (2K) and hypertensive (2K-1C) rat aortas. The results of concentration–effect responses are also represented by the area under the curve (AUC, in arbitrary units). Data represent the mean ± s.e.m . (n = 4–10). *Difference at the maximum effect of losartan vs control (P < 0.05); Student's t-test.
Citation: Vascular Biology 6, 1; 10.1530/VB-23-0021
NO-Synthase inhibition does not counter-regulate Ang II-induced contraction in 2K-1C rat aorta
We evaluated how endothelial nitric oxide (NO) and ROS contributed to the Ang II-induced contractile response. According to Fig. 3A, the NOS inhibitor L-NAME increased Emax (from 0.38 ± 0.12 g; n = 10 to 1.01 ± 0.15 g; n = 11; P = 0.0052) and amplitude of AUC (from 0.54 ± 0.14 to 1.57 ± 0.24, arbitrary units; P = 0.0037) in 2K rat aorta, but the pD2 values remained similar to the control (L-NAME pD2: 8.48 ± 0.07; n = 11 vs control pD2: 8.47 ± 0.10; n = 10). However, L-NAME did not change Ang II-induced contraction in 2K-1C rat aorta, Emax (L-NAME: 0.36 ± 0.14 g; n = 10 vs control: 0.23 ± 0.08 g; n = 7), pD2 (L-NAME: 8.50 ± 0.15; n = 10 vscontrol: 8.37 ± 0.14; n = 7) or AUC (L-NAME: 0.85 ± 0.29 vs control 0.29 ± 0.10, arbitrary units) values.
Endothelial enzymes contributing to Ang II-induced contractions. Concentration–effect curves to Ang II were constructed in the absence (open circle, open square) or in the presence of the enzyme inhibitors (closed circle, closed square) L-NAME (100 µmol/L) (A, B), apocynin (100 µmol/L) (C, D), or indomethacin (indo,10 µmol/L) (E, F) in endothelium-intact normotensive (2K) and hypertensive (2K-1C) rat aortic rings. The area under the curve (AUC, in arbitrary units) were calculated from the individual concentration–response curve plots. Data represent the mean ± s.e.m. (n = 5–11). *Difference at the maximum effect of L-NAME vs control (P < 0.05) by Student's t-test.
Citation: Vascular Biology 6, 1; 10.1530/VB-23-0021
Among other effects, Ang II induces ROS production mediated by activation of Nox isoforms. Thus, we tested whether the Nox inhibitor apocynin could affect Ang II-induced contraction. As shown by the results obtained, apocynin did not alter Ang II-induced contraction in 2K (Fig. 3C) and 2K-1C (Fig. 3D) rat aortas (2K, Emax: 0.26 ± 0.05 g, pD2: 8.31 ± 0.06, AUC: 0.36 ± 0.05; 2K-1C, Emax: 0.16 ± 0.03 g, pD2: 8.18 ± 0.11, AUC: 0.11 ± 0.06). COX inhibition with indomethacin provided similar results (2K, Emax: 0.18 ± 0.04 g, pD2: 8.32 ± 0.10, AUC: 0.26 ± 0.05; 2K-1C, Emax: 0.27 ± 0.08, pD2: 7.98 ± 0.21, AUC: 0.37 ± 0.11).
eNOS mRNA quantification and NOx levels are lower in 2K-1C than in 2K rat aortas
Particularly because NO produced by eNOS has a counter-regulatory effect on Ang II-induced contraction, we tested the RNA expression of eNOS in endothelium-intact 2K-1C and 2K rat aortas. As shown in the Fig. 4A, RNA was nearly 40% lower in 2K-1C as compared to the values obtained in 2K rat aorta. In addition, we demonstrate that NOx levels are decreased in plasma from 2K-1C groups (0.1652 ± 0.01968, µmol/µg) compared to 2K (0.3342 ± 0.02687, µmol/µg) (Fig. 4B).
eNOS mRNA and NO levels. (A) eNOS mRNA expression levels measured in rat aorta homogenate through by qRT-PCR (ΔΔ Ϲt) and normalized to GAPDH. (B) NO levels measured in plasma from normotensive (2K) and hypertensive (2K-1C) rats. Data represent mean ± s.e.m. (n = 5–6). *Difference between 2K-1C vs 2K rats (P = 0.00030) by Student's t-test.
Citation: Vascular Biology 6, 1; 10.1530/VB-23-0021
Ang II-induced contraction is counter-regulated by endothelial cells
To evaluate how endothelial factors and the activation of receptors expressed in VSMC affect Ang II-induced contraction, we used endothelium-intact and denuded aortas. As depicted in Fig. 5A, endothelium removal increased pD2 (E−: 9.00 ± 0.07; n = 9 vs E+: 8.47 ± 0.10; n = 10), Emax (E−: 1.64 ± 0.14 g; n = 9 vs E+: 0.38 ± 0.12 g; n = 10) and AUC (E−: 3.10 ± 0.30 vs E+: 0.54 ± 0.17, arbitrary units) to Ang II in 2K rat aorta. In 2K-1C rat aorta, endothelium removal also increased Emax (E−: 0.74 ± 0.12 g; n = 11 vs E+: 0.23 ± 0.08 g; n = 7) and AUC (E−: 1.23 ± 0.19 vs E+: 0.29 ± 0.08, arbitrary units) to Ang II, but the values of pD2 to Ang II remained unaltered (E−: 8.49 ± 0.13; n = 11 vs E+: 8.37 ± 0.14; n = 7) (Fig. 5B). We also observed a further reduction in Ang II-induced contraction in 2K-1C E− than in 2K E− aortic rings (Emax 2K: 1.64 ± 0.14 g; n = 9 vs Emax 2K-1C: 0.74 ± 0.12 g; n = 11), (pD2 2K: 9.00 ± 0.07; n = 9 vs pD2 2K-1C: 8.49 ± 0.13; n = 11), (AUC 2K: 3.10 ± 0.30 vsAUC 2K-1C: 1.23 ± 0.19, arbitrary units).
Effect of endothelium removal on Ang II-induced contraction Concentration–effect curves to Ang II were constructed for (A,B) endothelium-intact (E+) or (A,B,C) denuded (E−) normotensive (2K) and hypertensive (2K-1C) rat aortas and are expressed as area under the curve (AUC, in arbitrary units) from individual concentration–response curve plots. Data represent mean ± s.e.m. ( n = 7–11). *Difference at the maximum effect between E+ vs E− or 2K-1C vs 2K (P < 0.05). #Difference at the pD2 between E+ vs E− (P < 0.05) by Student's t-test.
Citation: Vascular Biology 6, 1; 10.1530/VB-23-0021
Expression of AT1 , but not AT2, in aorta and Ang II plasma levels are higher in 2K-1C than in 2K rats
Given that Ang II activates AT1 and AT2 receptors in VSMC, we evaluated their expression in 2K-1C and 2K rat aortas. Based on Fig. 6A, AT1 receptor expression was higher in 2K-1C than in 2K rat aortas. However, 2K-1C and 2K rat aortas did not differ in terms of AT2 receptor expression (Fig. 6B). Ang II plasma levels were also higher in 2K-1C than in 2K rat aortas (Fig. 6C).
Basal AT1 and AT2 receptor expression in the aorta and Ang II plasma levels. (A) AT1 and (B) AT2 receptor expression in normotensive (2K) and hypertensive (2K-1C) rats. (C) ELISA detection of Ang II levels in 2K and 2K-1C rat plasma. Data represent mean ± s.e.m . (n = 5–6). *Difference between 2K-1C vs 2K (P < 0.05) by Student's t-test.
Citation: Vascular Biology 6, 1; 10.1530/VB-23-0021
KCl depolarization induces weaker contraction in 2K-1C than in 2K rat aortas
To evaluate contraction regardless to receptor activation, we induced contraction by depolarization with 120 mmol/L KCl before constructing the concentration–curve effect to Ang II for some E+ and E− aortic rings. Endothelium removal increased KCl-induced contraction in 2K (E+: 2.01 ± 0.14 g; n = 8 vsE−: 2.58 ± 0.21 g; n = 7), but not in 2K-1C (E+: 1.62 ± 0.21 g; n = 7 vs E−: 1.39 ± 0.16 g; n = 9) rat aortic rings. In denuded aortas, the response was lower in 2K-1C than in 2K (1.39 ± 0.16 g; n = 9 vs2.58 ± 0.21 g, respectively) (Fig. 7).
KCl-induced contraction in rat aorta. Contractile response was induced by KCl (120 mmol/L) in 2K and 2K-1C rat aortic rings. Data represent the mean ± S.E.M. (n = 7–9). *Difference at the maximum effect between E+ vs E− (P < 0.05). #Difference at the maximum effect between 2K-1C vs 2K (P < 0.05) by two-way ANOVA.
Citation: Vascular Biology 6, 1; 10.1530/VB-23-0021
Basal IP3 receptor phosphorylation is lower in 2K-1C than 2K rat aorta VSMC
We also evaluated the basal phospho-IP3 receptor levels in E− aortic vessels. According to Fig. 8, phospho-IP3 receptor expression was lower in 2K-1C than in 2K rat aortas (Fig. 8A), whereas 2K-1C and 2K rat aortas did not differ in terms of total IP3 receptor (Fig. 8B) or myosin light chain enzyme expression (Fig. 8C).
Basal phospho-IP3 receptor, IP3 receptor, and MLC expression in rat aorta. (A) phospho-IP3 receptor, (B) IP3 receptor, and (C) MLC expression were quantified in 2K and 2K-1C rat aorta VSMC. Data represent the mean ± s.e.m. (n = 4). *Difference between 2K-1C vs 2K (P < 0.05) by Student's t-test.
Citation: Vascular Biology 6, 1; 10.1530/VB-23-0021
Discussion
In this study, we investigated the underlying molecular mechanisms of Ang II-induced contraction in 2K and 2K-1C rat aortas. Intriguingly, our results showed that Ang II induced similar contraction in endothelium-intact 2K and 2K-1C rat aortic rings. Although the 2K-1C rat aorta presents dysfunctional eNOS, it does not seem to interfere with the contractile process induced by Ang II. However, endothelium removal increased Ang II-induced contraction in 2K compared to 2K-1C rat aortic rings, but AT1 receptor expression was higher in 2K-1C rat aortic rings. In addition, 2K-1C rat displayed increased Ang II plasma levels, but lower basal expression of phosphorylated IP3 receptors. These data demonstrate that although the 2K-1C rat aorta presents increased expression of the AT1 receptor, the contraction induced by Ang II was lower in the 2K-1C than in 2K rat aorta because the IP3 receptor phosphorylation is reduced, that impairs the calcium release from the sarcoplasmic reticulum, which is necessary for the contraction.
In accordance to Navar et al. (24), Ang II concentrations are increased in the plasma of 2K-1C rats after unilateral renal artery stenosis. Ang II acts as the main effector peptide of the RAAS system and, through direct vascular effects, and then Ang II rapidly increases total peripheral resistance, to culminate in elevated blood pressure (25, 26). Based on our data, the systolic blood pressure increased progressively in 2K-1C rats, but it remained constant in 2K rats. Other research groups demonstrated that blood pressure begins to increase between the first and second weeks after the clip is implanted in 2K-1C rat renal artery (16, 27, 28, 29, 30), which supports our data. We also found endothelial dysfunction characterized by impaired endothelium-dependent relaxation, a known characteristic of hypertensive animals.
As observed in Fig. 2A, endothelium-intact 2K-1C and 2K aortic rings had similar low-grade concentration–effect curves to Ang II. Low-grade Ang II-induced contraction has been reported in normotensive rat aorta (31). Thus, Ang II induced weak contraction, which seems to be a characteristic of this peptide. In addition, Oliveira and collaborators (32) observed different results, where the contraction induced by Ang II was greater in the aortic rings of 2K-1C compared to 2K. However, the rats were used three weeks after surgery, which differs from our work.
We also evaluated the type of Ang II receptor that is involved in this response. To this end, we used losartan, a selective AT1 receptor antagonist, and PD123319, a selective AT2 receptor antagonist. Because Ang II can indirectly act through Mas receptors under ACE2 effects, we also used A779 to inhibit Mas receptors. Inhibition of AT2 or Mas receptors did not change the profile of the concentration–effect curves to Ang II in 2K-1C or 2K rat aortic rings. In fact, only AT1 receptor blockade abolished the Ang II vasoconstrictor response in both groups, which means that only AT1 participated in the vasoconstrictor response in the presence of endothelium. Levy et al. (33) reported similar results.
Endothelial dysfunction associated with increased release of COX-pathway products (34) and elevated ROS production (16, 35) has been reported in 2K-1C rat vessels. This increase in vasoconstrictor substances and ROS impairs endothelium-dependent relaxation in aortic rings (20, 30, 35, 36) and mesenteric arteries (35, 37, 38, 39) of renovascular hypertension models. Moreover, decreased eNOS expression has been reported in aortas (40, 41), which has been linked to lower NO levels (16, 35, 42) in 2K-1C rats. Therefore, we used pharmacological tools to evaluate these different pathways. NOS inhibition with L-NAME increased the vasoconstrictor effect of Ang II in 2K rat aortic rings because NOS is functionally active in 2K rat vessels. However, L-NAME shifted the concentration–effect curves slightly to the right without changing the contractile effect of Ang II in 2K-1C rat aortic rings, which could be associated with the decreased eNOS mRNA and NO levels observed in 2K-1C rat aortas compared to 2K rat aortas. Application of recombinant adenovirus expressing the eNOS functional gene to 2K-1C rats, to induce eNOS overexpression, can prevent the development of renovascular hypertension, confirming eNOS dysfunction in this model (43).
The increase in COX-pathway products (34) and ROS (16, 35) can modulate the vasoconstrictor effect of phenylephrine in 2K-1C rat aortic rings, as reported by our research group (44). However, COX-pathway inhibition with indomethacin or ROS inhibition with apocynin did not change the Ang II-induced vasoconstrictor response in 2K-1C and 2K rat aortic rings in the presence of endothelium. These results suggest that, in this case, COX-pathway products and ROS did not participate in the Ang II-induced contractile response.
Interestingly, the Ang II-induced maximum effect in denuded 2K rat aortic rings was higher than in 2K-1C rat aortic rings, despite increased AT1 receptor expression in 2K-1C rat aorta. On the other hand, AT2 receptor expression did not change in 2K-1C rat aorta compared to 2K rat aorta. As mentioned before by other groups (35, 45) and also confirmed here with our data showing that Ang II levels were higher in 2K-1C rat plasma than in 2K rat plasma.
Based on the literature, the time course of Ang II levels in 2K-1C model presents different stages after clipping of the renal artery. In the early phase (approximately 2 weeks after clipping), high blood pressure is induced by plasma renin activity and high levels of circulating Ang II levels. In the later phase (after 4 weeks of clipping), plasma renin activity and Ang II levels are reduced, but hypertension is maintained (45). It was demonstrated that Ang II levels induce upregulation of AT1 receptor expression due to its role on the regulation of transcription factors NF-κB and Elk-1 in a neuronal cell model (46). In addition, Ang II levels regulate proximal tubule AT1 receptor expression since Ang II increases AT1 receptor mRNA at least in part by decreasing proximal tubule cAMP generation through a pertussis toxin-sensitive mechanism (47). Moreover, statin withdrawal in VSMC promotes an increase in Ang II levels and Ang II signaling due to rise AT1 receptor density and its transcription (48). In this way, different studies have reported increased AT1 receptor expression (29, 33) and high Ang II levels (33) in 2K-1C rat aorta, corroborating our data, also in renal tissue (49). These results suggest that high levels of Ang II are associated to upregulation of AT1 receptor expression.
It is important to highlight that prolonged AT1 receptor activation in aorta VSMC mediates AT1 receptor internalization (50). In addition, overexpression of G protein-coupled receptor kinases (GRKs) 2, 3, or 5 augmented the agonist-induced AT1A-receptor phosphorylation, indicating the role of one or several GRKs in the rapid agonist-induced desensitization of the AT1A-receptor (51). Moreover, in glomerulosa cells, high concentrations of Ang II desensitize AT1 receptor-mediated cellular responses in the long term (22). Therefore, the Ang II-induced maximum effect that is reduced in denuded aortic rings of 2K-1C can be explained by the fact that AT1 receptors may act as a checkpoint for the regulation of direct Ang II effects on target tissues. Taken together, these results suggest that increased Ang II levels can regulate AT1 receptor by its internalization (52) and/or desensitization (51), thus avoiding its hyper-activation.
Ang II binding to AT1 receptors in VSMC stimulates phospholipase β (PLC-β), which hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2), thus generating the second messenger IP3 and diacylglycerol (53). IP3 activates IP3 receptors on the sarcoplasmic reticulum membrane, releasing the stored calcium (11, 53). Hence, we assume that some changes in calcium mobility through the membrane could take place or its storage in the sarcoplasmic reticulum could be altered in renovascular hypertension.
We verified that one single KCl (120 mmol/L) concentration contracted endothelium-intact 2K-1C and 2K rat aortic rings in a similar way, while KCl-stimulated contraction increased in denuded 2K rat aortic rings but not changed in denuded 2K-1C rat aortic rings. This result can be explained by the fact that aorta from 2K-1C demonstrates changes in the electric gradient (15), which could compromise the 2K-1C aortas in reaching the maximum response stimulated by a single dose of high concentration of KCl.
Other point to be considered is that high concentrations of extracellular KCl promote a contractile effect on VSMC through cell membrane depolarization, which is followed by activation of voltage-operated calcium channels and calcium release from the sarcoplasmic reticulum (54). Then, we analyzed IP3 receptor phosphorylation. Interestingly, IP3 receptor deletion results in lower smooth muscle contractile ability to different agonists as well as lower systolic blood pressure upon chronic Ang II infusion (55). Here, total IP3 receptor expression or MLC in 2K-1C and 2K rat aortas did not change, but basal IP3 receptor phosphorylation was reduced in 2K-1C rat VSMC. These results suggest that calcium release from the sarcoplasmic reticulum was decreased. It could be related to decreased contractile effect of Ang II seen in denuded 2K-1C rat aortic rings. How the constant stimulation of AT1 receptors in hypertensive animals can induce lower IP3 receptor phosphorylation levels or whether these alterations are produced by changes in other components of the classic PLCβ-IP3-diacylglicerol pathway needs to be clarified in future studies.
Although our study brings new findings to the area of vascular biology, it has limitations, as it does not prove the internalization or desensitization of the AT1 receptor associated with high levels of Ang II as it was suggested in the discussion.
Conclusion
The maximum contraction induced by Ang II is similar in intact endothelium aortic rings from 2K and 2K-1C. On the other hand, the maximum contraction stimulated by Ang II was reduced in denuded aortic rings of 2K-1C, which is associated with the impairment of IP3 receptor phosphorylation observed in VSMC of 2K-1C rats. Therefore, this result demonstrates the importance of the role of calcium released from the sarcoplasmic reticulum for the Ang II-induced contraction.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the study reported.
Funding
This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) (Grant 2017/14797-9) and by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) (Grant 305601/2018-0). BMF was a FAPESP doctoral fellow (Grant 2016/20322-0). SRP is Productivity Researcher at UEMG – PQ/UEMG. Financial support of this study did not involve data collection or analysis, manuscript drafting, or decision to submit the manuscript for publication.
Author Contributions
BMF and LMB conceived and designed the experiments; BMF, SRP, TDP and MDG performed the experiments; BMF, SRP, TDP and MDG analyzed the data; LMB provided the drugs and all the necessary materials; BMF, SRP, and TDP discussed the data; BMF, SRP, TDP, and LMB contributed to manuscript drafting. All the authors contributed to the article and approved the submitted version.
Acknowledgements
The authors thank Juliana A. Vercesi for technical support (Faculty of Pharmaceutical Sciences of Ribeirão Preto-USP). The graphical abstract was created at Servier Medical Art.
References
- 1↑
Konukoglu D, & Uzun H. Endothelial dysfunction and hypertension. Advances in Experimental Medicine and Biology 2017 956 511–540. (https://doi.org/10.1007/5584_2016_90)
- 2↑
Touyz RM, Alves-Lopes R, Rios FJ, Camargo LL, Anagnostopoulou A, Arner A, & Montezano AC. Vascular smooth muscle contraction in hypertension. Cardiovascular Research 2018 114 529–539. (https://doi.org/10.1093/cvr/cvy023)
- 3↑
Forrester SJ, Booz GW, Sigmund CD, Coffman TM, Kawai T, Rizzo V, Scalia R, & Eguchi S. Angiotensin II signal transduction: an update on mechanisms of physiology and pathophysiology. Physiological Reviews 2018 98 1627–1738. (https://doi.org/10.1152/physrev.00038.2017)
- 4↑
Robles NR, Cerezo I, & Hernandez-Gallego R. Renin-angiotensin system blocking drugs. Journal of Cardiovascular Pharmacology and Therapeutics 2014 19 14–33. (https://doi.org/10.1177/1074248413501018)
- 5↑
Sasaki K, Yamano Y, Bardhan S, Iwai N, Murray JJ, Hasegawa M, Matsuda Y, & Inagami T. Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II Type-1 receptor. Nature 1991 351 230–233. (https://doi.org/10.1038/351230a0)
- 6↑
Akazawa H, Yano M, Yabumoto C, Kudo-Sakamoto Y, & Komuro I. Angiotensin II type 1 and type 2 receptor-induced cell signaling. Current Pharmaceutical Design 2013 19 2988–2995. (https://doi.org/10.2174/1381612811319170003)
- 7↑
Kawai T, Forrester SJ, O'Brien S, Baggett A, Rizzo V, & Eguchi S. AT1 receptor signaling pathways in the cardiovascular system. Pharmacological Research 2017 125 4–13. (https://doi.org/10.1016/j.phrs.2017.05.008)
- 8↑
Kaschina E, Namsolleck P, & Unger T. AT2 receptors in cardiovascular and renal diseases. Pharmacological Research 2017 125 39–47. (https://doi.org/10.1016/j.phrs.2017.07.008).
- 9↑
Ferrario CM, & Iyer SN. Angiotensin-(1-7): a bioactive fragment of the renin-angiotensin system. Regulatory Peptides 1998 78 13–18. (https://doi.org/10.1016/s0167-0115(9800134-7)
- 10↑
Santos RA. Angiotensin-(1-7). Hypertension 2014 63 1138–1147. (https://doi.org/10.1161/HYPERTENSIONAHA.113.01274)
- 11↑
Wynne BM, Chiao CW, & Webb RC. Vascular smooth muscle cell signaling mechanisms for contraction to angiotensin II and endothelin-1. Journal of the American Society of Hypertension 2009 3 84–95. (https://doi.org/10.1016/j.jash.2008.09.002)
- 12↑
Nguyen Dinh Cat A, Montezano AC, Burger D, & Touyz RM. Angiotensin II, NADPH oxidase, and redox signaling in the vasculature. Antioxidants and Redox Signaling 2013 19 1110–1120. (https://doi.org/10.1089/ars.2012.4641)
- 13↑
Savoia C, Burger D, Nishigaki N, Montezano A, & Touyz RM. Angiotensin II and the vascular phenotype in hypertension. Expert Reviews in Molecular Medicine 2011 13 e11. (https://doi.org/10.1017/S1462399411001815)
- 14↑
Nair R, & Vaqar S. Renovascular hypertension. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing, 2023. Available at: https://www.ncbi.nlm.nih.gov/books/NBK551587/.
- 15↑
Callera GE, Varanda WA, & Bendhack LM. Ca2+ Influx is Increased in 2-kidney, 1-clip Hypertensive Rat aorta. Hypertension 2001 38 592–596. (https://doi.org/10.1161/hy09t1.096248)
- 16↑
Castro MM, Rizzi E, Ceron CS, Guimaraes DA, Rodrigues GJ, Bendhack LM, Gerlach RF, & Tanus-Santos JE. Doxycycline ameliorates 2K-1C hypertension-induced vascular dysfunction in rats by attenuating oxidative stress and improving nitric oxide bioavailability. Nitric Oxide: Biology and Chemistry 2012 26 162–168. (https://doi.org/10.1016/j.niox.2012.01.009)
- 17↑
Rodrigues GJ, Restini CBA, Lunardi CN, Neto MA, Moreira JE, & Bendhack LM. Decreased number of caveolae in endothelial cells impairs the relaxation induced by acetylcholine in hypertensive rat aortas. European Journal of Pharmacology 2010 627 251–257. (https://doi.org/10.1016/j.ejphar.2009.11.010)
- 18↑
Amaral JH, Rizzi ES, Alves-Lopes R, Pinheiro LC, Tostes RC, & Tanus-Santos JE. Antioxidant and antihypertensive responses to oral nitrite involves activation of the Nrf2 pathway. Free Radical Biology and Medicine 2019 141 261–268. (https://doi.org/10.1016/j.freeradbiomed.2019.06.028)
- 19↑
Oliveira-Sales EB, Dugaich AP, Carillo BA, Abreu NP, Boim MA, Martins PJ, D’Almeida V, Dolnikoff MS, Bergamaschi CT, & Campos RR. Oxidative stress contributes to renovascular hypertension. American Journal of Hypertension 2008 21 98–104. (https://doi.org/10.1038/ajh.2007.12)
- 20↑
Guimaraes DA, Dos Passos MA, Rizzi E, Pinheiro LC, Amaral JH, Gerlach RF, Castro MM, & Tanus-Santos JE. Nitrite exerts antioxidant effects, inhibits the mTOR pathway and reverses hypertension-induced cardiac hypertrophy. Free Radical Biology and Medicine 2018 120 25–32. (https://doi.org/10.1016/j.freeradbiomed.2018.03.006)
- 21↑
Mattos BR, Bonacio GF, Vitorino TR, Garcia VT, Amaral JH, Dellalibera-Joviliano R, et al.TNF-alpha inhibition decreases MMP-2 activity, reactive oxygen species formation and improves hypertensive vascular hypertrophy independent of its effects on blood pressure. Biochemistry and Pharmacology 2020 180 114–121.
- 22↑
Richard DE, Laporte SA, Bernier SG, Leduc R, & Guillemette G. Desensitization of AT1 receptor-mediated cellular responses requires long term receptor down-regulation in bovine adrenal glomerulosa cells. Endocrinology 1997 138 3828–3835. (https://doi.org/10.1210/endo.138.9.5409)
- 23↑
Calebiro D, & Godbole A. Internalization of G-protein-coupled receptors: implication in receptor function, physiology and diseases. Best Practice and Research. Clinical Endocrinology and Metabolism 2018 32 83–91. (https://doi.org/10.1016/j.beem.2018.01.004)
- 24↑
Navar LG, Zou L, von Thun A, Tarng-Wang C, Imig JD, & Mitchell KD. Unraveling the mystery of Goldblatt hypertension. News in Physiological Sciences 1998 13 170–176. (https://doi.org/10.1152/physiologyonline.1998.13.4.170)
- 25↑
Huang WC, Ploth DW, & Navar LG. Angiotensin-mediated alterations in nephron function in Goldblatt hypertensive rats. American Journal of Physiology 1982 243 F553–F560. (https://doi.org/10.1152/ajprenal.1982.243.6.F553)
- 26↑
Navar LG, von Thun AM, Zou L, el-Dahr SS, & Mitchell KD. Enhancement of intrarenal angiotensin II levels in 2 kidney 1 clip and angiotensin II induced hypertension. Blood Pressure. Supplement 1995 2 88–92.
- 27↑
Guimarães DA, Rizzi E, Ceron CS, Pinheiro LC, Gerlach RF, & Tanus-Santos JE. Atorvastatin and sildenafil lower blood pressure and improve endothelial dysfunction, but only atorvastatin increases vascular stores of nitric oxide in hypertension. Redox Biology 2013 1 578–585. (https://doi.org/10.1016/j.redox.2013.11.004)
- 28↑
Pereira TM, Balarini CM, Silva IV, Cabral AM, Vasquez EC, & Meyrelles SS. Endogenous angiotensin II modulates nNOS expression in renovascular hypertension. Brazilian Journal of Medical and Biological Research 2009 42 685–691. (https://doi.org/10.1590/s0100-879x2009000700014)
- 29↑
Santuzzi CH, Tiradentes RV, Mengal V, Claudio ER, Mauad H, Gouvea SA, & Abreu GR. Combined aliskiren and L-arginine Treatment has antihypertensive Effects and Prevents Vascular Endothelial Dysfunction in a Model of Renovascular hypertension. Brazilian Journal of Medical and Biological Research 2015 48 65–76. (https://doi.org/10.1590/1414-431x20144191)
- 30↑
Skogstrand T, Leh S, Paliege A, Reed RK, Vikse BE, Bachmann S, Iversen BM, & Hultström M. Arterial damage precedes the development of interstitial damage in the nonclipped kidney of two-kidney, one-clip hypertensive rats. Journal of Hypertension 2013 31 152–159. (https://doi.org/10.1097/HJH.0b013e32835a5d4e)
- 31↑
Leite R, Estevao R, Resende AC, & Salgado MC. Role of endothelium in angiotensin II formation by the rat aorta and mesenteric arterial bed. Brazilian Journal of Medical and Biological Research 1997 30 649–656. (https://doi.org/10.1590/s0100-879x1997000500013)
- 32↑
Oliveira PR, Oliveira PB, Rossignoli PS, Spadella MA, & Chies AB. Exercise training attenuates angiotensin II-induced vasoconstriction in the aorta of normotensive but not hypertensive rats. Experimental Physiology 2020 105 732–742. (https://doi.org/10.1113/EP088139)
- 33↑
Levy BI, Benessiano J, Henrion D, Caputo L, Heymes C, Duriez M, Poitevin P, & Samuel JL. Chronic blockade of AT2-subtype receptors prevents the effect of angiotensin II on the rat vascular structure. Journal of Clinical Investigation 1996 98 418–425. (https://doi.org/10.1172/JCI118807)
- 34↑
Silva BR, Pernomian L, De Paula TD, Grando MD, & Bendhack LM. Endothelial nitric oxide synthase and cyclooxygenase are activated by hydrogen peroxide in renal hypertensive rat aorta. European Journal of Pharmacology 2017 814 87–94. (https://doi.org/10.1016/j.ejphar.2017.07.047)
- 35↑
Wunpathe C, Potue P, Maneesai P, Bunbupha S, Prachaney P, Kukongviriyapan U, Kukongviriyapan V, & Pakdeechote P. Hesperidin suppresses renin-angiotensin system mediated NOX2 over-expression and sympathoexcitation in 2K-1C hypertensive rats. American Journal of Chinese Medicine 2018 46 751–767. (https://doi.org/10.1142/S0192415X18500398)
- 36↑
Choi S, Ryu KH, Park SH, Jun JY, Shin BC, Chung JH, & Yeum CH. Direct vascular actions of quercetin in aorta from renal hypertensive rats. Kidney Research and Clinical Practice 2016 35 15–21. (https://doi.org/10.1016/j.krcp.2015.12.003)
- 37↑
Dias AT, Cintra AS, Frossard JC, Palomino Z, Casarini DE, Gomes IBS, Balarini CM, Gava AL, Campagnaro BP, Pereira TMC, et al.Inhibition of phosphodiesterase 5 restores endothelial function in renovascular hypertension. Journal of Translational Medicine 2014 12 250. (https://doi.org/10.1186/s12967-014-0250-x)
- 38↑
Dohi Y, Criscione L, & Lüscher TF. Renovascular hypertension impairs formation of endothelium-derived relaxing factors and sensitivity to endothelin-1 in resistance arteries. British Journal of Pharmacology 1991 104 349–354. (https://doi.org/10.1111/j.1476-5381.1991.tb12434.x)
- 39↑
Schäfer SC, Pellegrin M, Wyss C, Aubert JF, Nussberger J, Hayoz D, Lehr HA, & Mazzola L. Intravital microscopy reveals endothelial dysfunction in resistance arterioles in angiotensin II-induced hypertension. Hypertension Research 2012 35 855–861. (https://doi.org/10.1038/hr.2012.58)
- 40↑
Boonla O, Kukongviriyapan U, Pakdeechote P, Kukongviriyapan V, Pannangpetch P, Prachaney P, & Greenwald SE. Curcumin improves endothelial dysfunction and vascular remodeling in 2K-1C hypertensive rats by raising nitric oxide availability and reducing oxidative stress. Nitric Oxide: Biology and Chemistry 2014 42 44–53. (https://doi.org/10.1016/j.niox.2014.09.001)
- 41↑
Hong MH, Jin XJ, Yoon JJ, Lee YJ, Oh HC, Lee HS, Kim HY, & Kang DG. Antihypertensive effects of Gynura divaricata (L.) DC in rats with renovascular hypertension. Nutrients 2020 12 3321. (https://doi.org/10.3390/nu12113321)
- 42↑
Rezazadeh H, Hosseini-Kahnouei M, Hassanshahi G, Allahtavakoli M, Shamsizadeh A, Roohbakhsh A, Fatemi I, Zarisfi M, & Pourshanazari AA. Regulatory effects of chronic low-dose morphine on nitric oxide level along with baroreflex sensitivity in two-kidney one-clip hypertensive rats. Iranian Journal of Kidney Diseases 2014 8 194–200.
- 43↑
Gava AL, Peotta VA, Cabral AM, Vasquez EC, & Meyrelles SS. Overexpression of eNOS prevents the development of renovascular hypertension in mice. Canadian Journal of Physiology and Pharmacology 2008 86 458–464. (https://doi.org/10.1139/y08-044)
- 44↑
Silva BR, Pernomian L, Grando MD, Amaral JH, Tanus-Santos JE, & Bendhack LM. Hydrogen peroxide modulates phenylephrine-induced contractile response in renal hypertensive rat aorta. European Journal of Pharmacology 2013 721 193–200. (https://doi.org/10.1016/j.ejphar.2013.09.036)
- 45↑
Silva MC, Azevedo MA, Figueiredo VP, Moura Junior MR, Coelho Junior D, Martinelli PM, Machado RP, Alzamora AC, & Talvani A. Renovascular hypertension increases serum TNF and CX3CL1 in experimental Trypanosoma cruzi infection. Brazilian Journal of Medical and Biological Research 2018 51 e6690. (https://doi.org/10.1590/1414-431X20186690)
- 46↑
Mitra AK, Gao L, & Zucker IH. Angiotensin II-induced upregulation of AT(1) receptor expression: sequential activation of NF-kappaB and Elk-1 in neurons. American Journal of Physiology. Cell Physiology 2010 299 C561–C569. (https://doi.org/10.1152/ajpcell.00127.2010)
- 47↑
Cheng HF, Becker BN, Burns KD, & Harris RC. Angiotensin II upregulates type-1 angiotensin II receptors in renal proximal tubule. Journal of Clinical Investigation 1995 95 2012–2019. (https://doi.org/10.1172/JCI117886)
- 48↑
Castejon AM, Zollner E, Tristano AG, & Cubeddu LX. Upregulation of angiotensin II-AT1 receptors during statin withdrawal in vascular smooth muscle cells. Journal of Cardiovascular Pharmacology 2007 50 708–711. (https://doi.org/10.1097/FJC.0b013e318157c0b2)
- 49↑
Modrall JG, Quinones MJ, Frankhouse JH, Hsueh WA, Weaver FA, & Kedes L. Upregulation of angiotensin II type 1 receptor gene expression in chronic renovascular hypertension. Journal of Surgical Research 1995 59 135–140. (https://doi.org/10.1006/jsre.1995.1144).
- 50↑
Bian J, Lei J, Yin X, Wang P, Wu Y, Yang X, Wang L, Zhang S, Liu H, & Fu MLX. AT1 receptor internalization is a novel mechanism underlying sustained vasoconstriction induced by AT1 receptor autoantibody from preeclampsia. Journal of the American Heart Association 2019 8 e011179. (https://doi.org/10.1161/JAHA.118.011179)
- 51↑
Oppermann M, Freedman NJ, Alexander RW, & Lefkowitz RJ. Phosphorylation of the type 1A angiotensin II receptor by G protein-coupled receptor kinases and protein kinase C. Journal of Biological Chemistry 1996 271 13266–13272. (https://doi.org/10.1074/jbc.271.22.13266)
- 52↑
Thomas WG, Thekkumkara TJ, Motel TJ, & Baker KM. Stable expression of a truncated AT1A receptor in CHO-K1 cells. The carboxyl-terminal region directs agonist-induced internalization but not receptor signaling or desensitization. Journal of Biological Chemistry 1995 270 207–213. (https://doi.org/10.1074/jbc.270.1.207)
- 53↑
Berk BC, & Corson MA. Angiotensin II signal transduction in vascular smooth muscle: role of tyrosine kinases. Circulation Research 1997 80 607–616. (https://doi.org/10.1161/01.res.80.5.607)
- 54↑
Ratz PH, Berg KM, Urban NH, & Miner AS. Regulation of smooth muscle calcium sensitivity: KCl as a calcium-sensitizing stimulus. American Journal of Physiology. Cell Physiology 2005 288 C769–C783. (https://doi.org/10.1152/ajpcell.00529.2004)
- 55↑
Lin Q, Zhao G, Fang X, Peng X, Tang H, Wang H, Jing R, Liu J, Lederer WJ, Chen J, et al.IP3 receptors regulate vascular smooth muscle contractility and hypertension. JCI Insight 2016 1 e89402. (https://doi.org/10.1172/jci.insight.89402)
